Zdrowe zioła
Naturalne sposoby na codzienne zdrowie

Posts Tagged ‘przedszkole ekologiczne kwidzyn’

Tiotropium w astmie słabo kontrolowane za pomocą standardowej terapii skojarzonej AD 3

Posted in Uncategorized  by admin
September 1st, 2019

Pomoc redakcyjną zapewniły Międzynarodowe Spotkania i Nauki. Przedstawiciele firmy Boehringer Ingelheim zaprojektowali i przeprowadzili badanie z pierwszym autorem oraz zebrali i przeanalizowali dane. Finansowanie prób i pomoc redakcyjna zostały dostarczone przez Boehringer Ingelheim i Pfizer. Leki próbne i towarzyszące
Pacjenci byli losowo przydzielani do samodzielnego podawania dwóch wdechów 2,5 .g (tj. Read the rest of this entry »

Comments Off

Posts Tagged ‘przedszkole ekologiczne kwidzyn’

Tiotropium w astmie słabo kontrolowane za pomocą standardowej terapii skojarzonej AD 3

Posted in Uncategorized  by admin
September 1st, 2019

Oceniliśmy wpływ na czynność płuc, częstość zaostrzeń i inne punkty końcowe w okresie 48 tygodni u pacjentów z źle kontrolowaną astmą. Metody
Charakterystyka pacjenta
Kwalifikujący się pacjenci byli w wieku od 18 do 75 lat i mieli pięcioletnią lub dłuższą historię astmy, która została zdiagnozowana przed 40 rokiem życia. Pacjenci byli zobowiązani do uzyskania 1,5 lub więcej punktów w Kwestionariuszu Kontroli Astmy 7 (ACQ-7), który składa się z siedmiu pytań, z których każdy był oceniany w zakresie od 0 (bez upośledzenia) do 6 (maksymalne upośledzenie), z minimalnym klinicznie istotna różnica 0,5 jednostki8; i aby utrzymać uporczywe ograniczenie przepływu powietrza, które zostało zdefiniowane jako zwiększona objętość wydechowa po podaniu leku rozszerzającego oskrzela w ciągu sekundy (FEV1) o 80% lub mniejszej wartości przewidywanej9 i 70% lub mniejszej wymuszonej pojemności życiowej (FVC) 30 minut po inhalacji czterech wdechów po 100 .g salbutamolu lub 90 .g albuterolu podczas wizyty przesiewowej, pomimo codziennej terapii glikokortykoidami wziewnymi (.800 .g budezonidu lub jego odpowiednika) i LABA. Pacjenci musieli mieć co najmniej jedno zaostrzenie, które było leczone ogólnoustrojowymi glikokortykoidami w poprzednim roku i być albo przez całe życie niepalących albo mieć palący historię palenia mniej niż 10 pack-lat, bez palenia w roku przed rejestracją. Read the rest of this entry »

Comments Off

Posts Tagged ‘przedszkole ekologiczne kwidzyn’

Tiotropium w astmie słabo kontrolowane za pomocą standardowej terapii skojarzonej AD 3

Posted in Uncategorized  by admin
September 1st, 2019

W przypadku fragmentów PCR, które dawały niewiarygodne wyniki zautomatyzowanej analizy sekwencjonowania, do starterów amplifikacji przyłączono ogon 5 zawierający startery do amplifikacji M13, a te standardowe primery zastosowano następnie w sekwencjonowaniu. Wykrywanie mutacji 185delAG
Aby zbadać mutację 185delAG w egzonie 2 BRCA1, genomowe DNA amplifikowano czterema starterami w pojedynczym PCR (temperatura hybrydyzacji, 58 ° C), jak następuje: starter (sensowny), komplementarny do sekwencji intronu 5 5 GAAGTTGTCATTTTATAAACCTTT3 ; primer 2 (antysensowny), komplementarny do mutacji 185delAG 5 TGACTTACCAGATGGGACACTA3 ; starter 3 (sensowny), komplementarny do sekwencji ekson 2 typu dzikiego 5 ATTAATGCTATGCAGAAAATCTTAGAG3 ; i starter 4 (antysensowny), komplementarny do sekwencji intronów 3 5 GTATGTAAGGTCAATTCTGTTC3 . Dla każdej próbki ta kombinacja starterów wytworzyła prążki 170 nukleotydów (specyficzne dla 185delAG), 118 nukleotydów (swoisty dla typu dzikiego) i 282 lub 284 nukleotydów (kontrola odpowiednio dla zmutowanych i dzikich alleli).
Analiza statystyczna
Dziewięćdziesiąt pięć procent przedziałów ufności dla oszacowań ryzyka i ilorazów szans obliczono za pomocą StatXact (Cytel). Związek pomiędzy ryzykiem rodzinnym a częstością mutacji testowano za pomocą dokładnego testu Fishera. Read the rest of this entry »

Comments Off

Next Entries »