Zdrowe zioła
Naturalne sposoby na codzienne zdrowie

Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5

Posted in Uncategorized  by admin
July 1st, 2019

W przypadku fragmentów PCR, które dawały niewiarygodne wyniki zautomatyzowanej analizy sekwencjonowania, do starterów amplifikacji przyłączono ogon 5 zawierający startery do amplifikacji M13, a te standardowe primery zastosowano następnie w sekwencjonowaniu. Wykrywanie mutacji 185delAG
Aby zbadać mutację 185delAG w egzonie 2 BRCA1, genomowe DNA amplifikowano czterema starterami w pojedynczym PCR (temperatura hybrydyzacji, 58 ° C), jak następuje: starter (sensowny), komplementarny do sekwencji intronu 5 5 GAAGTTGTCATTTTATAAACCTTT3 ; primer 2 (antysensowny), komplementarny do mutacji 185delAG 5 TGACTTACCAGATGGGACACTA3 ; starter 3 (sensowny), komplementarny do sekwencji ekson 2 typu dzikiego 5 ATTAATGCTATGCAGAAAATCTTAGAG3 ; i starter 4 (antysensowny), komplementarny do sekwencji intronów 3 5 GTATGTAAGGTCAATTCTGTTC3 . Dla każdej próbki ta kombinacja starterów wytworzyła prążki 170 nukleotydów (specyficzne dla 185delAG), 118 nukleotydów (swoisty dla typu dzikiego) i 282 lub 284 nukleotydów (kontrola odpowiednio dla zmutowanych i dzikich alleli).
Analiza statystyczna
Dziewięćdziesiąt pięć procent przedziałów ufności dla oszacowań ryzyka i ilorazów szans obliczono za pomocą StatXact (Cytel). Związek pomiędzy ryzykiem rodzinnym a częstością mutacji testowano za pomocą dokładnego testu Fishera. Ryzyko przypisane zostało oszacowane za pomocą metod stosowanych w badaniach retrospektywnych przy założeniu, że choroba była rzadka (a zatem iloraz szans był przybliżeniem względnego ryzyka) .22 Przewagę mutacji 185delAG w populacji żydowskiej oszacowano jako 8 na 858 osób, zgodnie z danymi podanymi gdzie indziej.19 Ponadto założyliśmy, że skumulowane ryzyko raka piersi w wieku 40 lat wynosi na 217 kobiet17.
Wyniki
Tabela 1. Tabela 1. Charakterystyka kliniczna 418 kobiet z wczesnym rakiem piersi. Rejestrowano dane kliniczne i próbki krwi obwodowej uzyskane dla 418 kobiet z obszaru metropolitalnego Bostonu, u których rozpoznano raka piersi w wieku 40 lat lub wcześniej. Aby przeprowadzić kompleksową mutacyjną analizę genu BRCA1, najpierw wybraliśmy 30 kobiet, które, jak podejrzewaliśmy, miały największe ryzyko predyspozycji genetycznych, ponieważ miały raka piersi przed ukończeniem 30 lat. Większość tych kobiet była dotknięta w wieku 20 i 29 z infiltrującym rakiem przewodowym, z rakiem przewodowym lub bez in situ, ale odnotowano również nowotwory o mniej powszechnych cechach histologicznych, w tym naciekające raki zrazikowe, rdzeniaste i anaplastyczne; jedno pięcioletnie dziecko miało młodzieńcze wydzielnicze gruczolakoraki. Oprócz diagnozy we wczesnym wieku, 5 z 30 kobiet miało obustronny rak piersi (2 pacjentów), określoną historię rodzinną raka piersi (jedną z nich dotyczyło trzech lub więcej krewnych ojców lub matek i pochodziło z dwóch lub więcej pokoleń , 2 pacjentów) lub oboje (1 pacjent) (tabela 1). Te cechy kliniczne, które silnie sugerują predyspozycje genetyczne, były podobne u kobiet z początkiem choroby przed 30 rokiem życia oraz u osób z początkiem 30 do 40. Wśród wszystkich 418 kobiet, które miały raka piersi w wieku 40 lat lub wcześniej, 168 (40 procent) miało co najmniej jednego krewnego pierwszego lub drugiego stopnia (przedział ufności 95 procent, 36 do 46 procent), liczba ta kontrastuje z szacunkami od 6 do 19 procent dla populacji ogólnej 10,11. większość kobiet w naszym badaniu nie należała do charakterystycznych rodowodów raka piersi i jajnika, ale stanowiła podgrupę ogólnej populacji, która ma zwiększone ryzyko genetycznych predyspozycji do raka piersi.
Badanie przesiewowe mutacji BRCA1 za pomocą testu PTT
Ponieważ duży rozmiar genu BRCA1 komplikuje badania mutacyjne, zastosowaliśmy dwa podejścia: test PTT, szybki test przesiewowy, który może wykryć mutacje kończące łańcuchy, 16,20,21 i automatyczne sekwencjonowanie nukleotydów połączone z użyciem oprogramowania w celu ułatwienia identyfikacja mutacji heterozygotycznych, metoda, która może wykrywać wszystkie substytucje nukleotydów w regionie kodującym BRCA1.
Tabela 2
[podobne: grot jędrzejów, przedszkole ekologiczne kwidzyn, allele wilkowice ]

Tags: , ,

No Responses to “Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5”

  1. Sandra Says:

    [..] Odniesienie w tekscie do zdrowa dieta[...]

  2. Ida Says:

    Milo sie czytalo

  3. Lena Says:

    [..] Oznaczono ponizsze tresci z artykulu oryginalnego: leki[...]

  4. Murmur Says:

    Mam zapalenie płuc od 5-ciu lat, lekarze są bezsilni.

Powiązane tematy z artykułem: allele wilkowice grot jędrzejów przedszkole ekologiczne kwidzyn