Zdrowe zioła
Naturalne sposoby na codzienne zdrowie

Archive for the ‘Uncategorized’ Category

Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5

Posted in Uncategorized  by admin
December 4th, 2018

W przypadku fragmentów PCR, które dawały niewiarygodne wyniki zautomatyzowanej analizy sekwencjonowania, do starterów amplifikacji przyłączono ogon 5 zawierający startery do amplifikacji M13, a te standardowe primery zastosowano następnie w sekwencjonowaniu. Wykrywanie mutacji 185delAG
Aby zbadać mutację 185delAG w egzonie 2 BRCA1, genomowe DNA amplifikowano czterema starterami w pojedynczym PCR (temperatura hybrydyzacji, 58 ° C), jak następuje: starter (sensowny), komplementarny do sekwencji intronu 5 5 GAAGTTGTCATTTTATAAACCTTT3 ; primer 2 (antysensowny), komplementarny do mutacji 185delAG 5 TGACTTACCAGATGGGACACTA3 ; starter 3 (sensowny), komplementarny do sekwencji ekson 2 typu dzikiego 5 ATTAATGCTATGCAGAAAATCTTAGAG3 ; i starter 4 (antysensowny), komplementarny do sekwencji intronów 3 5 GTATGTAAGGTCAATTCTGTTC3 . Dla każdej próbki ta kombinacja starterów wytworzyła prążki 170 nukleotydów (specyficzne dla 185delAG), 118 nukleotydów (swoisty dla typu dzikiego) i 282 lub 284 nukleotydów (kontrola odpowiednio dla zmutowanych i dzikich alleli).
Analiza statystyczna
Dziewięćdziesiąt pięć procent przedziałów ufności dla oszacowań ryzyka i ilorazów szans obliczono za pomocą StatXact (Cytel). Związek pomiędzy ryzykiem rodzinnym a częstością mutacji testowano za pomocą dokładnego testu Fishera. Read the rest of this entry »

Comments Off

Archive for the ‘Uncategorized’ Category

Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5

Posted in Uncategorized  by admin
December 4th, 2018

Zastosowanie niesklonowanych produktów PCR umożliwiło analizę obu alleli w jednej reakcji i zminimalizowanie błędów artefaktycznych w jednym produkcie. Najbardziej bezpośrednie podejście, analiza produktów PCR z odwrotną transkryptazą obejmujących cały transkrypt BRCA1, była komplikowana przez niski poziom ekspresji mRNA BRCA1 w jednojądrzastych komórkach krwi obwodowej i przez alternatywne splicing mRNA na końcu 5 transkryptu. Warunki były zatem optymalne do analizy sekwencjonowania za pomocą szablonów pochodzących z amplifikacji PCR zarówno genomowego DNA, jak i cDNA. Koniec 5 BRCA1 (eksony 2 do 5, 7 do 10 oraz 13 i 14) amplifikowano z genomowego DNA ze starterami komplementarnymi do sekwencji intronów flankujących każdy ekson. Te eksony nie mogą być z powodzeniem sekwencjonowane z cDNA jako pojedynczego fragmentu z powodu rozległego alternatywnego składania transkryptu BRCA1 w jednojądrzastych komórkach krwi obwodowej (alternatywne składanie eksonów 5, 9 i 10 oraz alternatywne zastosowanie połączeń splicingowych w eksonach 8 i 14 ). Read the rest of this entry »

Comments Off

Archive for the ‘Uncategorized’ Category

Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5

Posted in Uncategorized  by admin
December 4th, 2018

Sekwencja BRCA1 typu dzikiego była 5 GAAACA TGTAA3 (podkreślona). Delecja AT w jednym z dwóch alleli spowodowała przesunięcie w ramce odczytu i przedwczesny kodon stop. Oba allele są tutaj analizowane razem. W nici dodatniej sekwencja nukleotydów czyta się od lewej do prawej. Grot wskazuje miejsce delecji dwóch nukleotydów w jednym allelu i wynikową niezsynchronizowaną sekwencję: na prawo od grotu, dwa nukleotydy są rozpoznawane w każdej pozycji, z odpowiednią redukcją intensywności sygnału każdego z nich. Read the rest of this entry »

Comments Off

Archive for the ‘Uncategorized’ Category

Mutacje BRCA1 w linii germańskiej u kobiet żydowskich i nieżydowskich z rakiem piersi o wczesnym początku ad 5

Posted in Uncategorized  by admin
December 4th, 2018

Ponadto, badaliśmy kobiety żydowskie, które miały raka piersi we wczesnym wieku, aby określić obecność specyficznego allelu BRCA1 z mutacją w pozycji 185, obejmującą delecję adeniny i guaniny (185delAG), którą znaleziono niedawno w 1% Populacja Żydów aszkenazyjskich.19 Metody
Badaj pacjentów
Kobiety, u których rak piersi rozwinął się między rokiem 1981 a 1992 w wieku 40 lat lub wcześniej, zidentyfikowano poprzez retrospektywny przegląd dokumentacji medycznej w czterech ośrodkach skierowania na raka piersi w Bostonie – Massachusetts General Hospital, Dana-Farber Cancer Institute, Beth Israel Hospital, oraz Szpital Faulknera. Wśród 850 kwalifikujących się kobiet 418 zgodziło się oddać krew do analizy genów pod kątem podatności na raka piersi, których wyniki nie zostaną ujawnione. Próbki krwi zostały zakodowane, a poufność pacjentów została zachowana, zgodnie z wytycznymi dla badań ludzi poddanych współpracującym szpitalom. Historie medyczne i rodzinne oraz zmienne demograficzne (w tym religia i pochodzenie etniczne) uzyskano w bezpośrednich wywiadach, a patologiczne rozpoznanie potwierdzono przeglądem dokumentacji medycznej. W rygorystycznym określeniu obecności mutacji BRCA1 u kobiet z wczesnym rakiem piersi, cały region kodujący genu BRCA1 był analizowany w podgrupie 30 kobiet, u których rak piersi rozwinął się przed 30 rokiem życia. Read the rest of this entry »

Comments Off

« Previous Entries